Mature sequence cme-miR396d

Accession numberMIMAT0026147
IDcme-miR396d
Stem-Loop cme-MIR396d
Sequence
uuccacagcuuucuugaacuu
Get sequence
Deep sequencing reads, experiments

References

1
"The genome of melon (Cucumis melo L.)" Garcia-Masa J, Benjak A, Sanseverino W, Bourgeois M, Mir S, González VM, Hénaff E, Câmara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutiérrez S, Blanca J, Cañizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodríguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, PNAS [in press] (2012).
2
PMID:22753475 "The genome of melon (Cucumis melo L.)" Garcia-Mas J, Benjak A, Sanseverino W, Bourgeois M, Mir G, Gonzalez VM, Henaff E, Camara F, Cozzuto L, Lowy E, Alioto T, Capella-Gutierrez S, Blanca J, Canizares J, Ziarsolo P, Gonzalez-Ibeas D, Rodriguez-Moreno L, Droege M, Du L, Alvarez-Tejado M, Lorent Proc Natl Acad Sci U S A. 109:11872-11877(2012).