Mature sequence mmu-miR-3473e

Accession numberMIMAT0025587
IDmmu-miR-3473e
Stem-Loop mmu-mir-3473e
Sequence
gggcuggagagauggcucgua
Get sequence
Deep sequencing49085 reads, 97 experiments
Predicted targets

References

1
PMID:20605486 "Regulation of microRNA expression and abundance during lymphopoiesis" Kuchen S, Resch W, Yamane A, Kuo N, Li Z, Chakraborty T, Wei L, Laurence A, Yasuda T, Peng S, Hu-Li J, Lu K, Dubois W, Kitamura Y, Charles N, Sun HW, Muljo S, Schwartzberg PL, Paul WE, O'Shea J, Rajewsky K, Casellas R Immunity. 32:828-839(2010).