Mature sequence bta-miR-2285r

Accession numberMIMAT0025575
IDbta-miR-2285r
Stem-Loop bta-mir-2285r
Sequence
agaaaccuggaugaacuuuuugg
Get sequence
Deep sequencing1349 reads, 70 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).