Mature sequence bta-miR-2284z

Accession numberMIMAT0025559
IDbta-miR-2284z
Stem-Loop bta-mir-2284z-1 bta-mir-2284z-3 bta-mir-2284z-4 bta-mir-2284z-5 bta-mir-2284z-6 bta-mir-2284z-7 bta-mir-2284z-2
Sequence
aaaaaaguuuguuuggguuuuu
Get sequence
Deep sequencing73137 reads, 73 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2