Mature sequence bta-miR-1247-3p

Accession numberMIMAT0025550
IDbta-miR-1247-3p
Stem-Loop bta-mir-1247
Sequence
cgggaacgucgggacuggagc
Get sequence
Deep sequencing6 reads, 6 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).