Mature sequence bta-miR-154c

Accession numberMIMAT0025542
IDbta-miR-154c
Stem-Loop bta-mir-154c
Sequence
agauauugcacgguugaucucu
Get sequence
Deep sequencing7648 reads, 64 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).