Mature sequence bta-miR-2285m

Accession numberMIMAT0025533
IDbta-miR-2285m
Stem-Loop bta-mir-2285m-1 bta-mir-2285m-2 bta-mir-2285m-3 bta-mir-2285m-4 bta-mir-2285m-5
Sequence
aaaacgcaaaugaacuuuuugg
Get sequence
Deep sequencing610 reads, 62 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).