Mature sequence bta-miR-2285n

Accession numberMIMAT0025531
IDbta-miR-2285n
Stem-Loop bta-mir-2285n-1 bta-mir-2285n-2 bta-mir-2285n-3 bta-mir-2285n-4 bta-mir-2285n-5 bta-mir-2285n-6 bta-mir-2285n-7
Sequence
aaaaacccgaaugaacuuuugg
Get sequence
Deep sequencing24101 reads, 77 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).