Mature sequence bta-miR-3154

Accession numberMIMAT0025529
IDbta-miR-3154
Stem-Loop bta-mir-3154
Sequence
cagaaggggagucggagcaga
Get sequence
Deep sequencing13 reads, 13 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).