Mature sequence hsa-miR-6502-5p

Accession numberMIMAT0025460
IDhsa-miR-6502-5p
Stem-Loop hsa-mir-6502
Sequence
agcucuagaaagauuguugacc
Get sequence
Deep sequencing90 reads, 36 experiments
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).