Mature sequence ssc-miR-493-3p

Accession numberMIMAT0025378
IDssc-miR-493-3p
Stem-Loop ssc-mir-493
Sequence
ugaaggucuacugugugccagg
Get sequence
Deep sequencing14 reads, 7 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).