Mature sequence ssc-miR-31

Accession numberMIMAT0025360
IDssc-miR-31
Stem-Loop ssc-mir-31
Sequence
aggcaagaugcuggcauagcug
Get sequence
Deep sequencing434 reads, 12 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).