Mature sequence pde-miR396

Accession numberMIMAT0025332
IDpde-miR396
Stem-Loop pde-MIR396
Sequence
ucccacggcuuucuugaacuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22480283 "Transcriptome-wide identification and characterization of miRNAs from Pinus densata" Wan LC, Zhang H, Lu S, Zhang L, Qiu Z, Zhao Y, Zeng QY, Lin J BMC Genomics. 13:132(2012).