Mature sequence mmu-miR-451b

Accession numberMIMAT0025178
IDmmu-miR-451b
Stem-Loop mmu-mir-451b
Sequence
ugggagcagcaagagaaccgu
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).