Mature sequence mmu-miR-1957b

Accession numberMIMAT0025145
IDmmu-miR-1957b
Sequence
uggaauguaacucagugguau
Get sequence
Stem-Loop mmu-mir-1957b

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).