Mature sequence mmu-miR-6361

Accession numberMIMAT0025104
IDmmu-miR-6361
Stem-Loop mmu-mir-6361
Sequence
uggcucagcagucacccugugac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).