Mature sequence mmu-miR-6349

Accession numberMIMAT0025092
IDmmu-miR-6349
Sequence
uggaaugugggaggggcaugcg
Get sequence
Stem-Loop mmu-mir-6349

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).