Mature sequence hme-miR-34

Accession numberMIMAT0024983
IDhme-miR-34
Stem-Loop hme-mir-34-1 hme-mir-34-2
Sequence
uggcagugugguuagcugguug
Get sequence
Deep sequencing reads, experiments

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).