Mature sequence hme-miR-285

Accession numberMIMAT0024970
IDhme-miR-285
Stem-Loop hme-mir-285
Sequence
uagcaccauucgaauucagugc
Get sequence
Deep sequencing reads, experiments

References

1
"Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature 2012 [Epub ahead of print].
2
PMID:22722851 "Butterfly genome reveals promiscuous exchange of mimicry adaptations among species" The Heliconius Genome Consortium Nature. 487:94-98(2012).