Mature sequence osa-miR5512b

Accession numberMIMAT0024872
IDosa-miR5512b
Stem-Loop osa-MIR5512b
Sequence
uaggauaugguaaugcuaaaa
Get sequence
Deep sequencing33 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).