Mature sequence osa-miR6249a

Accession numberMIMAT0024871
IDosa-miR6249a
Stem-Loop osa-MIR6249a
Sequence
cgugaagagcucgccggcggc
Get sequence
Deep sequencing384 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).