Mature sequence osa-miR6248

Accession numberMIMAT0024869
IDosa-miR6248
Stem-Loop osa-MIR6248
Sequence
uauuugaggauggagguagua
Get sequence
Deep sequencing51 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).