Mature sequence osa-miR6246

Accession numberMIMAT0024867
IDosa-miR6246
Stem-Loop osa-MIR6246
Sequence
uuggggauuuccugccggaggaa
Get sequence
Deep sequencing5 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).