Mature sequence osa-miR1440b

Accession numberMIMAT0024866
IDosa-miR1440b
Stem-Loop osa-MIR1440b
Sequence
uuuaggagagugguauuugag
Get sequence
Deep sequencing71 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).