Mature sequence mmu-miR-6240

Accession numberMIMAT0024861
IDmmu-miR-6240
Stem-Loop mmu-mir-6240
Sequence
ccaaagcaucgcgaaggcccacggcg
Get sequence
Deep sequencing9160 reads, 102 experiments
Database links
Predicted targets
QuickGO function

References

1