Mature sequence nta-miR167d

Accession numberMIMAT0024660
IDnta-miR167d
Stem-Loop nta-MIR167d
Sequence
ugaagcugccagcaugaucua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22353177 "Identification of wounding and topping responsive small RNAs in tobacco (Nicotiana tabacum)" Tang S, Wang Y, Li Z, Gui Y, Xiao B, Xie J, Zhu QH, Fan L BMC Plant Biol. 12:28(2012).