Mature sequence bta-miR-2285g

Accession numberMIMAT0024582
IDbta-miR-2285g
Stem-Loop bta-mir-2285g-1 bta-mir-2285g-2 bta-mir-2285g-3
Sequence
aaaccugaacaagcuuuuugg
Get sequence
Deep sequencing5359 reads, 74 experiments
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).
2