Mature sequence mse-miR-11

Accession numberMIMAT0024422
IDmse-miR-11
Stem-Loop mse-mir-11
Sequence
caucacagucagaguucuagcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22406339 "Identification and developmental profiling of conserved and novel microRNAs in Manduca sexta" Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H Insect Biochem Mol Biol. 42:381-395(2012).