Mature sequence mes-miR399a

Accession numberMIMAT0024418
IDmes-miR399a
Stem-Loop mes-MIR399a
Sequence
ugccaaaggagaauugcccug
Get sequence
Deep sequencing reads, experiments

References

1
"Overview of the potential of microRNAs and their target gene detection for cassava (Manihot esculenta) improvement" Amiteye S, Corral JM, Sharbel TF African J Biotech. 10:(2011).