Mature sequence ggo-miR-340

Accession numberMIMAT0024087
IDggo-miR-340
Stem-Loop ggo-mir-340
Sequence
uuauaaagcaaugagacugau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).