Mature sequence ptr-miR-548o

Accession numberMIMAT0024054
IDptr-miR-548o
Stem-Loop ptr-mir-548o
Sequence
aaaaguaauugcgguuuuugcc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).