Mature sequence cgr-miR-19b-3p

Accession numberMIMAT0023841
IDcgr-miR-19b-3p
Stem-Loop cgr-mir-19b
Sequence
ugugcaaauccaugcaaaacuga
Get sequence
Deep sequencing17616 reads, 6 experiments

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).