Mature sequence cgr-miR-183

Accession numberMIMAT0023806
IDcgr-miR-183
Stem-Loop cgr-mir-183
Sequence
auggcacugguagaauucacug
Get sequence
Deep sequencing309 reads, 6 experiments

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).