Mature sequence cgr-miR-143

Accession numberMIMAT0023772
IDcgr-miR-143
Stem-Loop cgr-mir-143
Sequence
ugagaugaagcacuguagcuc
Get sequence
Deep sequencing309 reads, 6 experiments

References

1
PMID:21392545 "Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering" Hackl M, Jakobi T, Blom J, Doppmeier D, Brinkrolf K, Szczepanowski R, Bernhart SH, Honer Zu Siederdissen C, Bort JA, Wieser M, Kunert R, Jeffs S, Hofacker IL, Goesmann A, Puhler A, Borth N, Grillari J J Biotechnol. 153:62-75(2011).