Mature sequence hsa-miR-6088

Accession numberMIMAT0023713
IDhsa-miR-6088
Stem-Loop hsa-mir-6088
Sequence
agagaugaagcgggggggcg
Get sequence
Deep sequencing33 reads, 21 experiments
Predicted targets

References

1
PMID:22142236 "Discovery and characterization of novel microRNAs during endothelial differentiation of human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Noh HM, Kwon YD, Yoo H, Yi HS, Chung HM, Kim JK Stem Cells Dev. 21:2049-2057(2012).