Mature sequence bna-miR6028

Accession numberMIMAT0023648
IDbna-miR6028
Stem-Loop bna-MIR6028
Sequence
uggagaguaaggacauucaga
Get sequence
Deep sequencing reads, experiments

References

1