Mature sequence bna-miR860

Accession numberMIMAT0023645
IDbna-miR860
Stem-Loop bna-MIR860
Sequence
ucaauacauuggacuacauau
Get sequence
Deep sequencing reads, experiments

References

1