Mature sequence bna-miR395f

Accession numberMIMAT0023641
IDbna-miR395f
Stem-Loop bna-MIR395f
Sequence
cugaaguguuuggggggacuc
Get sequence
Deep sequencing reads, experiments

References

1