Mature sequence bna-miR166f

Accession numberMIMAT0023625
IDbna-miR166f
Stem-Loop bna-MIR166f
Sequence
ucggaccaggcuucauccccc
Get sequence
Deep sequencing reads, experiments

References

1