Mature sequence stu-miR6026-3p

Accession numberMIMAT0023609
IDstu-miR6026-3p
Stem-Loop stu-MIR6026
Sequence
uucuuggcuagaguuguauugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).