Mature sequence stu-miR6023

Accession numberMIMAT0023591
IDstu-miR6023
Stem-Loop stu-MIR6023
Sequence
uuccaugaaaguguuuuuggau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).