Mature sequence dpr-miR396

Accession numberMIMAT0023536
IDdpr-miR396
Stem-Loop dpr-MIR396
Sequence
uuccacagcuuucuugaacug
Get sequence
Deep sequencing reads, experiments

References

1