Mature sequence hco-miR-5904c

Accession numberMIMAT0023418
IDhco-miR-5904c
Stem-Loop hco-mir-5904c
Sequence
caaacccacuauuuucacuucga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).