Mature sequence osa-miR5143b

• Accession number: MIMAT0023289
• ID: osa-miR5143b
• Stem-Loop: osa-MIR5143b
• Sequence: ugugguauguuggcaauguaggaa
• Deep sequencing: 12 reads, 2 experiments

References

1. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).