Mature sequence hsa-miR-5787

Accession numberMIMAT0023252
IDhsa-miR-5787
Stem-Loop hsa-mir-5787
Sequence
gggcuggggcgcggggaggu
Get sequence
Deep sequencing8 reads, 7 experiments
Predicted targets

References

1
PMID:22062548 "The hsa-miR-5787 represses cellular growth by targeting eukaryotic translation initiation factor 5 (eIF5) in fibroblasts" Yoo H, Yoo JK, Lee J, Lee DR, Ko JJ, Oh SH, Choo YK, Kim JK Biochem Biophys Res Commun. 415:567-572(2011).