Mature sequence hsa-miR-5739

Accession numberMIMAT0023116
IDhsa-miR-5739
Stem-Loop hsa-mir-5739
Sequence
gcggagagagaauggggagc
Get sequence
Deep sequencing5 reads, 5 experiments
Predicted targets

References

1
PMID:22020071 "The hsa-miR-5739 modulates the endoglin network in endothelial cells derived from human embryonic stem cells" Yoo JK, Kim J, Choi SJ, Kim CH, Lee DR, Chung HM, Kim JK Biochem Biophys Res Commun. 415:258-262(2011).