Mature sequence tur-miR-5731-3p

Accession numberMIMAT0023057
IDtur-miR-5731-3p
Stem-Loop tur-mir-5731
Sequence
ugggcaccuaggcuaugucca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22113690 "The genome of Tetranychus urticae reveals herbivorous pest adaptations" Grbic M, Van Leeuwen T, Clark RM, Rombauts S, Rouze P, Grbic V, Osborne EJ, Dermauw W, Ngoc PC, Ortego F, Hernandez-Crespo P, Diaz I, Martinez M, Navajas M, Sucena E, Magalhaes S, Nagy L, Pace RM, Djuranovic S, Smagghe G, Iga M, Christiaens O, Veenstra JA Nature. 479:487-492(2011).