Mature sequence bra-miR5725

Accession numberMIMAT0023024
IDbra-miR5725
Stem-Loop bra-MIR5725
Sequence
auuuggcacaaucugaucugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).