Mature sequence bra-miR5724

Accession numberMIMAT0023023
IDbra-miR5724
Stem-Loop bra-MIR5724
Sequence
aaccgccgguuugauaauagc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).