Mature sequence bra-miR5723

Accession numberMIMAT0023022
IDbra-miR5723
Stem-Loop bra-MIR5723
Sequence
aaugugcugcaauaucucugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).